*Exchange rate ref. BCCR. The supplier can change the price of the product. Aeropost is an online shopping services provider. Total price includes all charges . NM_c+A>G; NM_c+A>T . ss, BGI|BGI_rs, fwd/B, C/T, aatggcaaaatgataaattgtggtcttctg. ss, BGI|BGI_rs, rev/B, G/T, ctgttgagtgaaggctgtgttcttggaggg, agtattctttgaataaactgatgaattcca, 06/06/08, 06/18/09, , Genomic, unknown.

Author: Arajind Kajigar
Country: Armenia
Language: English (Spanish)
Genre: Health and Food
Published (Last): 19 August 2017
Pages: 75
PDF File Size: 16.99 Mb
ePub File Size: 2.50 Mb
ISBN: 819-6-29599-545-9
Downloads: 16350
Price: Free* [*Free Regsitration Required]
Uploader: Vonris

Draft genome of the lined seahorse, Hippocampus erectus | GigaScience | Oxford Academic

We report a draft genome of the lined seahorse. The lined seahorse, Hippocampus erectusis an Atlantic species and mainly inhabits shallow sea beds or coral reefs. Previously classified as 2-nitropropane dioxygenase EC 1.

C ]; nitrite [CPD: Oxidoreductases; Acting on paired donors, with incorporation or reduction of molecular oxygen; With reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen into the other donor. A two-protein component enzyme. Gadda G, Francis K.

In progress issue alert. A total of The enzyme from N. Xun L, Sandvik ER. Related articles in Web of Science Bvi Scholar.

Published by Oxford University Press. In order to improve the aquaculture yield of this valuable fish species, we are trying to develop genomic resources for assistant selection in genetic breeding. Using homology-based, de novo and transcriptome-based prediction methods, we predicted 20 protein-coding genes in the generated assembly, which is less than our previously reported gene number 23 of the tiger tail seahorse H.

  BC417 BLUETOOTH MODULE PDF

NAD P H reductase subfamily. Biochim Biophys Acta The contig N50 and scaffold N50 reached ExplorEnz – The Enzyme Database: Availability of supporting data. Neither hydrogen peroxide nor superoxide were detected during enzyme turnover.

These generated genomic data are going to enrich genome resource of this economically important fish, and also provide insights into the genetic mechanisms of its iconic morphology and male pregnancy behavior. The enzyme from Escherichia coli attacks a broad spectrum of phenolic compounds. GigaScienceVolume 6, Issue 6, 1 Junegix, https: Oxford University Press is a department of the University of Oxford.

KEGG ORTHOLOGY: K

C ]; other products. C ]; O2 [CPD: Draft genome of the lined seahorse, Hippocampus erectus Qiang Lin. Appl Environ Microbiol R R R R R J Biol Chem Identification of the catalytic base. Citing articles via Web of Science 2.

Preços referenciais B3 – prêmios de opções

J Biol Chem Francis K, Gadda G. Receive exclusive offers and updates from Oxford Academic. Sign In or Create an Account.

Here, we provide bbgi genome sequencing, assembly, and gene annotation of the lined seahorse, which can enrich genome resource and further application bggi its molecular breeding. Re analyzing community-wide datasets without major infrastructure. The enzyme uses FADH2 as a substrate rather than a cofactor [4].

  MANIPULACIONES VISCERALES BARRAL PDF

Characterization of the anthranilate degradation pathway in Geobacillus thermodenitrificans NG Characterization of an Escherichia coli aromatic hydroxylase with a broad substrate range.

Molecular characterization of 4-hydroxyphenylacetate 3-hydroxylase of Escherichia coli. Oxidoreductases; Acting on single donors with incorporation of molecular oxygen oxygenases ; With incorporation of one atom of oxygen internal monooxygenases or internal mixed-function oxidases.

Sponsors of Barbados Gospelfest 2018 “Touching Lives Changing Nations”

Functional analysis of the small component of the 4-hydroxyphenylacetate 3-monooxygenase of Escherichia coli W: Kinetic evidence for an anion binding pocket in the active site of nitronate monooxygenase. Crystal structure of 2-nitropropane dioxygenase complexed with FMN and substrate. It has become very popular in China for its wide use in traditional Chinese medicine.

Characterization of 4-hydroxyphenylacetate 3-hydroxylase HpaB of Escherichia bti as a reduced flavin adenine dinucleotide-utilizing monooxygenase. The enzymes from the fungus Byi crassa and the yeast Williopsis saturnus var.